How many k-mers are in a sequence?

Table of Contents

The sequence ATGG has two 3-mers: ATG and TGG….Introduction.

k	k-mers
1	G, T, A, G, A, G, C, T, G, T
2	GT, TA, AG, GA, AG, GC, CT, TG, GT
3	GTA, TAG, AGA, GAG, AGC, GCT, CTG, TGT
4	GTAG, TAGA, AGAG, GAGC, AGCT, GCTG, CTGT

What does a K-Mer represent?

k-mer can indicate low quality or contamination in your sequences. Usually you compute it by checking if there is a string of length k that occurs in the reads more than chance. Tools like Fastqc can also give you a visual representation to that and to what kind of sequence you see.

What is K-mer counting?

k-mer counting involves counting the number of substrings that have length k in a string S, or a set of strings, where k is a positive integer.

What is canonical k-mers?

A canonical k-mer is the numerical lesser of a k-mer and its reverse complement. This is useful in hashing/counting k-mers in data that is not strand specific, and thus observing k-mer is equivalent to observing its reverse complement.

How do you know what size K Mer to get?

The optimal kmer-length should be less than read length Other than that there are not really any strict rules, just the longer the read, and the more coverage, generally the longer the kmer you can use.

What is the most frequent 3 MER of?

GTG is the most frequent 3-mer which appeared four times in the given sequence.

What does 10x coverage mean?

x coverage (or -fold covergae is used to describe the sequencing depth. For example, if your genome has a size of 10 Mbp and you have 100 Mbp of sequencin data that is assembled to said 10 Mbp genome, you have 10x coverage.

What is the best K Mer value?

Also, the best k-mer length was 61, and this should be the k-mer size when running an assembler such as Velvet, SOAPdenovo 2, ABySS, or Minia. KmerGenie outputs some great plots which show why k=61 was the choice.

What is the most frequent 3-MER of Taaacgtgagagaaacgtgctgattacacttgttcgtgtggtat?

What is the most frequent 3-mer of TAAACGTGAGAGAAACGTGCTGATTACACTTGTTCGTGTGGTAT? Missing information: Kindly provide more background information on the topic. All tutors are evaluated by Course Hero as an expert in their subject area. GTG is the most frequent 3-mer which appeared four times in the given sequence.

How do you calculate sequence coverage?

Sequencing coverage or depth (coverage and depth are used interchangeably) determines the number of times sequenced nucleotide bases covered the target genome. For example, if genome size is 100 Mbp and you have sequenced 5 M reads of 100 bp size, then sequencing coverage at genome level would be 5X.

How many k-mer’s can be generated from a given sequence?

For a given sequence of length L, and a K-mer size of K, the total k-mer’s possible will be given by ( L – k ) + 1 e.g. For the sequence of length of 14 , and a K-mer length of 8, the number of K-mer’s generated will be:

What are the 2 and 3 Mers of the sequence aattggccg?

For example: All 2-mers of the sequence AATTGGCCG are AA, AT, TT, TG, GG, GC, CC, CG. Similarly, all 3-mers of the sequence AATTGGCCG are AAT, ATT, TTG, TGG, GGC, GCC, CCG.

What is the frequency of k-mer spectroscopy in human genomes?

The number of modes within a k -mer spectrum can vary between regions of genomes as well: humans have unimodal k -mer spectra in 5′ UTRs and exons but multimodal spectra in 3′ UTRs and introns . The frequency of k -mer usage is affected by numerous forces, working at multiple levels, which are often in conflict.

Why are there so many unique k-mers in my genome?

The large number of unique (near unique) K-mers that have a frequency of 1-7 (the extreme left side of the graph) is due to technical error in sequencing. The big peak at 36 in the graph above is in fact the homozygous portions of the genome that account for the identical 21-mers from both strands of the DNA.